GENEALOGY-DNA-L Archives

Archiver > GENEALOGY-DNA > 2005-03 > 1111620417


From: Doug McDonald <>
Subject: Re: [DNA] RE: DNA FRAGMENT ASSEMBLY
Date: Wed, 23 Mar 2005 17:26:57 -0600
References: <1a1.30285e9f.2f734bba@aol.com>
In-Reply-To: <1a1.30285e9f.2f734bba@aol.com>


wrote:

> Maybe "stitch" didn't give the right image. We're talking about computer
> programs to align overlapping fragments of DNA sequence data. This is way
> over-simplified, but if you have two small fragments of sequence data
>
> TTGATC
> ATCGGA
>
> then the whole sequence would be
>
> TTGATCGGA
>

yes, but a bit more explanation is needed.

say you have in the actual whole chromosome


CCGATGCTTAGGTTGATCATCGGATTTCCCGTGGG

you might get fragments
CCGATGCTTAGGTT
TTAGGTTGATCATCGGAT
GGTTGATCATCGGATTTCCC
and
GGATTTCCCGTGGG,
which are pieces of the whole, left to right listed
top to bottom.

You have a computer try to piece them ... and a million others ...
together. The actual pieces used are usually much longer.

Doug McDonald


This thread: