GENEALOGY-DNA-L Archives

Archiver > GENEALOGY-DNA > 2005-06 > 1119194589


From: Thomas Krahn <>
Subject: Re: [DNA] DYS459a/b
Date: Sun, 19 Jun 2005 17:28:05 +0200
References: <061920050336.4859.42B4E8560007B219000012FB2200734076000001090407089F@comcast.net> <42B5350C.4000006@biotix.de> <00dc01c574dc$6bc8b530$61d32f50@Masterbedroom>
In-Reply-To: <00dc01c574dc$6bc8b530$61d32f50@Masterbedroom>


gareth.henson wrote:
> Thomas
>
> I think the trinucleotide repeat may be the one called DYF385S1 in the
> Kayser paper (the one reporting 166 or so new microsatellites). All 8
> samples tested (from 8 different haplogroups) showed 10 repeats.
> The primers in the file accompanying are CACCTCCAAATAAGTAAACATGGA
> and TCTGCCAACTGAAAGGAAAAA
> Do these primers match the section you are working on?
Yes, exactly. Thank you for pointing that out. However, the HUGO man
should have two separate alleles. I would expect that this is quite a
conservative/stable marker with not much variation, but it might be
interesting from the aspect of observing recombinational reductions of
heterocygosity.

>
> I'm not sure of the benefits of separating DYS459 a & b, there seems too
> little variation in almost every haplogroup, with the possible exception of
> I2.
Ken N. wouldn't agree with you, I guess...
I mainly try to get a better insight in duplicated markers in general.
Advanced methods in typing duplicated markers help us in making allele
calls correctly. I always whish to be able to distinguish two distinct
alleles with the same length from a deletion of one of the two alleles.

Thomas


This thread: