GENEALOGY-DNA-L Archives

Archiver > GENEALOGY-DNA > 2005-06 > 1119195795


From: "gareth.henson" <>
Subject: Re: [DNA] DYS459a/b
Date: Sun, 19 Jun 2005 16:43:15 +0100
References: <061920050336.4859.42B4E8560007B219000012FB2200734076000001090407089F@comcast.net> <42B5350C.4000006@biotix.de> <00dc01c574dc$6bc8b530$61d32f50@Masterbedroom> <42B58F05.1070308@biotix.de>


Thomas

thanks. Ken has already replied - yes, the complex history of hg I does seem
to justify looking at DYS459 more closely.

Re the nearby trinucleotide marker, yes HUGO man appears to have a 10,11
pattern. What would be interesting is finding a group or subgroup with
distinctive values, the two oldest known trinucleotides (388 and 392) both
appear to have higher mutation rates once the number of repeats reaches 14
or 15 (388 is known for high values in hg J, 392 in hg Q).

Gareth




----- Original Message -----
From: "Thomas Krahn" <>
To: <>
Sent: Sunday, June 19, 2005 4:28 PM
Subject: Re: [DNA] DYS459a/b


> gareth.henson wrote:
> > Thomas
> >
> > I think the trinucleotide repeat may be the one called DYF385S1 in the
> > Kayser paper (the one reporting 166 or so new microsatellites). All 8
> > samples tested (from 8 different haplogroups) showed 10 repeats.
> > The primers in the file accompanying are CACCTCCAAATAAGTAAACATGGA
> > and TCTGCCAACTGAAAGGAAAAA
> > Do these primers match the section you are working on?
> Yes, exactly. Thank you for pointing that out. However, the HUGO man
> should have two separate alleles. I would expect that this is quite a
> conservative/stable marker with not much variation, but it might be
> interesting from the aspect of observing recombinational reductions of
> heterocygosity.
>
> >
> > I'm not sure of the benefits of separating DYS459 a & b, there seems too
> > little variation in almost every haplogroup, with the possible exception
of
> > I2.
> Ken N. wouldn't agree with you, I guess...
> I mainly try to get a better insight in duplicated markers in general.
> Advanced methods in typing duplicated markers help us in making allele
> calls correctly. I always whish to be able to distinguish two distinct
> alleles with the same length from a deletion of one of the two alleles.
>
> Thomas



This thread: