GENEALOGY-DNA-L Archives

Archiver > GENEALOGY-DNA > 2005-06 > 1119318367


From: "Ken Nordtvedt" <>
Subject: Re: [DNA] FW: Question on markers and their status of importance
Date: Mon, 20 Jun 2005 19:46:07 -0600
References: <000001c575f4$1934fc20$210110ac@gateway.2wire.net>


A "marker" usually means a single tandem repeat (STR) which is a string of
repeats of some letter sequence in which the sequence repeats n times in
someone's ydna. For instance catcatcatcatcatcatcatcatcat would indicate 9
repeats of the genetic letter sequence "cat". I might be 9 at this marker
as indicated, but a distant cousin may have 10 repeats of "cat" or 8 repeats
because someone in my paternal ancestry or his had a mutation in the repeat
number of this STR or marker since our most recent common ancestor who of
course had some specific number of repeats at this marker.

The mutation rate for the number of repeats is quite a bit higher than other
more simple mutations which occur in the ydna. So that is why they are used
for genealogical purposes and for purposes of tracking the deep genetic
history of tribes. There are enough mutations of these kinds to create
diversity in a many marker haplotype. The molecular copying machine seems
to more easily get confused where he his in a string of repeats so miscopies
the repeat number at a higher rate than he goofs up simple copying tasks.
Or should be call the copying machine a "she"?

Depending on the haplogroup of your haplotypes, there are indeed some
markers which are much more important than others in 1) establishing that
haplogroup, and discerning differences between sub-groups within that
haplogroup, or 2) showing different lines in a genealogical tree. Some
markers mutate much faster than others, so they tend to show more diversity
of repeat values in a haplogroup, or within an extended genealogical family.
Yet a marker has persistence in a genealogical line: even the fastest
mutators used today only mutate on average about once every 100 generations.
Some mutate so slow there is a decent chance its value has not changed
between the world's genetic Adam and you.

If you have a 40 marker haplotype, then on average one of them mutates about
every 10 generations or less.

What haplogroups are you mainly dealing with? Haplotypes from different
haplogroups have most recent common ancestors pushed to thousands or tens of
thousands of years ago. So those cases are not of genealogical interest,
only deep ancestry and migrations of peoples filling the Earth or moving
from place to place.

Ken

----- Original Message -----
From: "William L Gammage" <>
To: <>
Sent: Monday, June 20, 2005 5:59 PM
Subject: [DNA] FW: Question on markers and their status of importance


In reading the postings, you all discuss different markers and their
values for comparisons, etc. I'm not sure exactly what each marker
would mean. What places the weight to each marker, and how should the
differences be read for each marker based on the weight placed on it?
I'm not sure if I'm even asking correctly. Maybe what I should be
asking is what markers should we place more importance on at 12, 25, 37
markers. At present, we have mainly 12 markers on our project members,
with 1 member going all the way to 37, and some other tests. I plan to
make that jump as I can make it. Because of the large differences among
the present participants, I would like to be able to put together some
sort of explanation on how to read and interpret the data. I do check
out the samples from other projects as they post the links, but, I feel
I'm still at a loss on what constitutes how we'll be able to either tie
the branches, or if we'll be left with completely different branches
regardless. My reason for this would be so I could formulate a good
reason to have some of the others in the project go ahead and extend
their tests to more markers. I guess one of my options would be to
start documenting where some ancestors have been, and using the
probabilities of the haplogroupings in some sort of explanation to
further their tests. As I have written in past postings, we are hoping
to get more project members within the next 30 days. All these would
and do have some documentary evidence of a common ancestor up to the mid
1700's. But it is at this point we are at a loss, trying to bridge that
crossing. And also I know there are other branches with well documented
lineages, but apparently have not really communicated, and might not
know of the project or might not be interested in making the investment.
Hoping some will get interested as time goes on. As far as I know, they
too probably are at the same brick wall as we are, unless someone has
information, that hasn't been published. I know we'll be continuing
with the project, and try and give some direction to those doing the
traditional research with what some of the DNA results might produce. I
hope I don't sound too confused. Thanks for any and all ideas, and
samples that can be reviewed.



William L Gammage

Proj Admin for

Gamage,Gammage,Gamache Project





==============================
Search Family and Local Histories for stories about your family and the
areas they lived. Over 85 million names added in the last 12 months.
Learn more: http://www.ancestry.com/s13966/rd.ashx




This thread: