GENEALOGY-DNA-L Archives

Archiver > GENEALOGY-DNA > 2005-06 > 1120155526


From: Robert Stafford <>
Subject: RE: [DNA] 113 Brazilian Haplotypes, unusual STR set
Date: Thu, 30 Jun 2005 11:18:46 -0700 (PDT)
In-Reply-To: <000801c57d8d$f44fac10$6f7ba8c0@thinkerone>


Robert,

The new ISFG recommendations are on John Butler's site. Here is the page with the link:

http://www.cstl.nist.gov/biotech/strbase/y_strs.htm

He is apparently writing up something to explain the changes and presumably NIST's recommendations. It will be posted there.

It appears that they scrambled the old high-value nomenclature a bit and ended up with one more repeat than before, but I am not really sure what was used before. According to this nomenclature, SMGF's locus should be called Y-GATA-H4.1, since they are not amplifying the H4.2 section. H4.2 contains 7 repeats. H2 is invariant in humans, but varies in chimps.

In the variant portion they count AGAT, instead of TAGA (SMGF/RG/DNAH) or GATA (FTDNA). The result is one less than the former and the same as the latter. There are also 10 invariant repeats in H4.1. So, it looks like you need to subtract 17 to get FTDNA and 16 to get SMGF/RG/DNAH values. Hopefully, someone who has had more experience in this will verify it.

Bob Stafford

Analysis:

I counted the sequence on the SMGF site according to the ISFG method. I had to extend it for the H4.2 repeats and three of the H4.1 repeats. SMGF's ends with a C where ISFG has an A, but I don't know why.

ISFG (28)

ATGCTGAGGAGAATTTCCAAATTTA/AGAT/AGAT/AGAT/AGAT/CTAT/AGAT/AGAT/

AGGT/AGGT/AGGT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/

AGAT/AGAT/AGAATGGATAGATTAGATGGATGA/ATAG/A

TAG/ATAG/ATAG/ATAC/ATAG/ATAG/

SMFG (12):

ATGCTGAGGAGAATTTCCAAATTTAAGATAGATAGATAGATCTATAGATAGAT

AGGTAGGTAGG/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/T

AGA/TAGA/TAGA/ATGGATAGATTAGATGGATGAATAGC



Robert Tarín <> wrote:
Bob,
I wondered about the conversion of the H4 values. What I found at YBASE was
a statement that the new lower nomenclature system since October 2002 is
exactly 15 lower than the original system. This would put the value in line
with SMGF, Relative Genetics, and DNA Heritage values. It is my
understanding that H4 values at FTDNA are 1 less than SMGF which would be
the result of subtracting 16. Am I misinterpreting this somehow? I could not
view the article you referenced although I did see the new allele range for
H4 at NIST.

Robert Tarín





This thread: