GENEALOGY-DNA-L Archives

Archiver > GENEALOGY-DNA > 2005-06 > 1120156813


From: Robert Davenport <>
Subject: Chimps and DNA
Date: Thu, 30 Jun 2005 11:40:13 -0700
References: <000801c57d8d$f44fac10$6f7ba8c0@thinkerone><20050630181846.12938.qmail@web81807.mail.mud.yahoo.com>
In-Reply-To: <20050630181846.12938.qmail@web81807.mail.mud.yahoo.com>


I can't find this article.

However, it has me wondering, do chimps have the same Y chromosone as we do?

Do they have their own Haplogroup?










At 11:18 AM 6/30/2005, you wrote:
>Robert,
>
>The new ISFG recommendations are on John Butler's site. Here is the page
>with the link:
>
>http://www.cstl.nist.gov/biotech/strbase/y_strs.htm
>
>He is apparently writing up something to explain the changes and
>presumably NIST's recommendations. It will be posted there.
>
>It appears that they scrambled the old high-value nomenclature a bit and
>ended up with one more repeat than before, but I am not really sure
>what was used before. According to this nomenclature, SMGF's locus should
>be called Y-GATA-H4.1, since they are not amplifying the H4.2 section.
>H4.2 contains 7 repeats. H2 is invariant in humans, but varies in chimps.
>
>In the variant portion they count AGAT, instead of TAGA (SMGF/RG/DNAH) or
>GATA (FTDNA). The result is one less than the former and the same as the
>latter. There are also 10 invariant repeats in H4.1. So, it looks like you
>need to subtract 17 to get FTDNA and 16 to get SMGF/RG/DNAH values.
>Hopefully, someone who has had more experience in this will verify it.
>
>Bob Stafford
>
>Analysis:
>
>I counted the sequence on the SMGF site according to the ISFG method. I
>had to extend it for the H4.2 repeats and three of the H4.1 repeats.
>SMGF's ends with a C where ISFG has an A, but I don't know why.
>
>ISFG (28)
>
>ATGCTGAGGAGAATTTCCAAATTTA/AGAT/AGAT/AGAT/AGAT/CTAT/AGAT/AGAT/
>
>AGGT/AGGT/AGGT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/
>
>AGAT/AGAT/AGAATGGATAGATTAGATGGATGA/ATAG/A
>
>TAG/ATAG/ATAG/ATAC/ATAG/ATAG/
>
>SMFG (12):
>
>ATGCTGAGGAGAATTTCCAAATTTAAGATAGATAGATAGATCTATAGATAGAT
>
>AGGTAGGTAGG/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/T
>
>AGA/TAGA/TAGA/ATGGATAGATTAGATGGATGAATAGC
>
>
>
>Robert Tarín <> wrote:
>Bob,
>I wondered about the conversion of the H4 values. What I found at YBASE was
>a statement that the new lower nomenclature system since October 2002 is
>exactly 15 lower than the original system. This would put the value in line
>with SMGF, Relative Genetics, and DNA Heritage values. It is my
>understanding that H4 values at FTDNA are 1 less than SMGF which would be
>the result of subtracting 16. Am I misinterpreting this somehow? I could not
>view the article you referenced although I did see the new allele range for
>H4 at NIST.
>
>Robert Tarín
>
>
>
>
>
>==============================
>View and search Historical Newspapers. Read about your ancestors, find
>marriage announcements and more. Learn more:
>http://www.ancestry.com/s13969/rd.ashx



This thread: