GENEALOGY-DNA-L Archives

Archiver > GENEALOGY-DNA > 2007-04 > 1176790169


From:
Subject: Re: [DNA] Samaritan Cohen are E3b1(M78) & DYS439
Date: Tue, 17 Apr 2007 06:09:29 +0000


In the methods section of Bonne-Tamir (2003) it says, "All individual s were genotyped for 12Y-STRs using two multiplex PCR reactions (Redd et al. 2002)."

Highlights from Redd (2002) tells us

"Multiplex II includes the following seven Y-STRs: DYS19, DYS388, DYS389(I and II), DYS392, DYS426, and DYS439. DYS19 was included in multiplex II as means of insuring sample continuity between PCR reactions in multiplex I and II. The 9-l PCR reactions contained: 10 ng of DNA, 1.0 l of 10X PCR buffer (100 mM TrisCHCl; pH 8.3, 500 mM KCl; 35 mM MgCl2), 0.25 units of Taq (Qiagen or Gibco), 0.055 ng of Clonetech antibody, 0.4 l of Clonetech Antibody Dilution Buffer (50 mM KCl, 10 mM TrisCHCl, pH 7.0, 50% glycerol), 222 M of each dNTP, 0.44 M DYS19 F and R, 0.08 M DYS388 F and R, 0.22 M DYS389 F and R, 0.10 M of DYS392 F and R, 0.04 M of DYS426 F and R, and 0.18 M of DYS439 F and R. The forward primer sequences of DYS19, DYS388, and DYS426 were 5 end-labeled with the fluorescent dye 6FAM; the forward primer sequences for DYS392 and DYS439 were 5 end-labeled with NED; and the forward primer sequences for DYS389 (I and II) was 5 end-labeled with HEX. We!
used n
ovel primer sequences for DYS439 (F was AATTAATAGATTCAAGGTGA, and R was CCCATCATCTCTTTACTATT) because we re-discovered this Y-STR in our search for novel Y-STRs (see Section 3.1 further). PCR cycling conditions were the same as described above in the uniplex PCR for the novel Y-STRs except that the denaturation time was 25 s and the extension time was 30 s."

SMGF(http://www.smgf.org/ychromosome/marker_details.jspx?marker=DYS439) gives:
DYS439 (Y-GATA-A4) (CEPH 1328-01)
Example Sequence:
TCGAGTTGTTATGGTTTTAGGTCTAACATTTAAGTCTTTAATCTATCTTGAATTAATA
GATTCAAGGTGATAGATATACAGATAGATAGATACATAGGTGGAGACAGATAGATGAT
AAATAGAA/GATA/GATA/GATA/GATA/GATA/GATA/GATA/GATA/GATA/GATA
/GATA/GATA/GAAAGTATAAGTAAAGAGATGATGGGTAAAAGAATTCCAAGCCAC

12 repeats, 217 bp (GATA)12

Now, I am probably over simplifying this but it looks like a simple case of different start points on different primers leading to different ladders.

Thoughts Al?

Regards,
Rebekah


This thread: