GENEALOGY-DNA-L Archives
Archiver > GENEALOGY-DNA > 2007-07 > 1185581283
From: "Gareth Henson" <>
Subject: Re: [DNA] A little note about haplogroup G Deep Clade tests
Date: Sat, 28 Jul 2007 01:08:03 +0100
References: <46AA77EA.3090904@familytreedna.com>
Thomas
for completeness, the full set of published palindromic P-series SNPs with 3
copies near DYF399 is:
P7 (haplogroup B2b4)
P18 (haplogroups G1a)
P20 (haplogroup G2a1)
P25 (haplogroup R1b1c)
P33 (haplogroup C2a)
All these SNPs are potentially subject to recLOH events of which 50% can be
expected to double the derived allele and 50% erase it (so restoring the
ancestral state). These patterns have been observed for P25 and there is a
note on the Haplogroup R page of the ISOGG tree explaining this.
P21 (haplogroup N3a1) is also found in the same segment but because the
segment (and DYF399) only has a single copy in haplogroup N this SNP may
actually be a phylogenetically valid marker. Do you have any records of
tests for this SNP?
Gareth
----- Original Message -----
From: "Thomas Krahn" <>
To: <>
Sent: Friday, July 27, 2007 11:55 PM
Subject: [DNA] A little note about haplogroup G Deep Clade tests
Dear List,
<snip>
It is very important to know that P16, P18 and P20 are palindromic SNPs
at Yq11. The exact positions can be visualized by reverse ePCR on the
NCBI site (http://www.ncbi.nlm.nih.gov/sutils/e-pcr/reverse.cgi):
Primer input:
P16 aggctccatctgtagcacac taaccttatagaccaaccccg 150-300
P18 tggatctgattcacaggtag ccaacaatatgtcacaatctc 500-750
P20 tggatctgattcacaggtag ccaacaatatgtcacaatctc 500-750
DYS464 TTACGAGCTTTGGGCTATG CCTGGGTAACAGAGAGACTCTT 200-400
DYF399 GGGTTTTCACCAGTTTGCAT CCATGTTTTGGGACATTCCT 250-350
DYS385 AGCATGGGTGACAGAGCTA TGGGATGCTAGGTAAAGCTG 350-450
Dataset: Homo sapiens gnome
DYS464, DYS385 and DYF399 are just added for better orientation on the
palindromic map.
http://www.ncbi.nlm.nih.gov/sutils/e-pcr/reverse.cgi?rid=46aa4ca6b6a7744c
The result can be displayed in Mapviewer:
http://www.ncbi.nlm.nih.gov/mapview/maps.cgi?taxid=9606&chr=Y&RID=46aa45dce0
197809&QUERY_NUMBER=*&remote=e-PCR&maps=epcr_set&cmd=focus
P18 and P20 are on the same 3 segments. They are close to the 3 DYF399
alleles on palindrome P1 and on the segment between P3 and P4
palindromes. So there are really three alleles that describe the SNP
state for each of these markers.
The theoretically possible results may be:
P18:
(C-)-(C-)-(C-) -> ancestral alleles at all 3 markers
(C-)-(C-)-(T+) -> ancestral alleles at 2 markers and derived allele on
one marker
(C-)-(T+)-(T+) -> ancestral alleles at one marker and derived on two markers
(T+)-(T+)-(T+) -> derived alleles at all markers
P20 in a more abbreviated form:
3(C-)
2(C-)-(delC+)
(C-)-2(delC+)
3(delC+)
We have observed the alleles 3(C-) and 2(C-)-(T+) at P18 and the alleles
3(C-) and 2(C-)-(delC+) at P20.
Of course a recLOH may change this very quickly and we haven't observed
enough derived states so that we get a clear picture at these markers.
The NCBI site seems to have some glitch at the region around palindrome
P4 because it shows 4 DYS385 alleles. In fact there are only two. P16 is
also on the palindrome P4 which means that there exist also two markers
which will be reported with two alleles:
2(A-) -> ancestral
(A-)-(T+) -> heterozygote
2(T+) -> pure derived
We have already observed all three states at P16 which proves that
recLOH happens.
This means that after the point mutation was acquired, some descendants
have copied over the SNP to the other palindromic arm which consolidated
the haplotype to a stable 2(T+) conformation. But on the other hand it
may have been also possible that a heterozygous P16 may have reverted to
2(A-) and the derived mutation was lost again although they are
phylogenetically below haplogroup G2a.
I would consider a 50% chance of reversals, the same number as 2(T+)
positives unless I know a reason for an asymmetrical distribution. For
this reason I no longer consider P16 as a phylogenetically relevant
marker and I propose to depreciate P16 (and P18 and P20) from the Y
haplogroup tree. On the other hand it may be worthwhile to have a closer
look at DYF411 because it is not far away from P16.
If you have a P15+ result consider testing the DYF411 marker, because
the modal in G2 is 11-14 and in case of a recLOH at palindrome 4 this
should collapse to 11-11 or 14-14. In deed I have already seen a G2 with
DYF411 = 14-14. This may suggest a "hidden" G2a haplotype.
For technical reasons the P16, P18 and P20 results will be uploaded in
the classical way, but customers that have any of the derived states at
these markers will be informed by e-mail on the complete details.
I would recommend to remove the branches below G2 on the ISOGG tree and
treat them like private SNPs.
<snip>
Thomas
This thread:
| Re: [DNA] A little note about haplogroup G Deep Clade tests by "Gareth Henson" <> |