GENEALOGY-DNA-L Archives

Archiver > GENEALOGY-DNA > 2009-07 > 1248181107


From: Doug McDonald <>
Subject: [DNA] more on R1a WTY results
Date: Tue, 21 Jul 2009 07:58:27 -0500


I've been looking at my R1a WTY results.

L168 is a plain SNP. It is an A in R1b and a G in my
R1a. Presumably A is ancestral or there would be
a reported SNP at this place in E or I.

L175 is an insertion of AAAAC. Actually is is
an (incipient?) STR. The R1b sequence is
GGGAAAAAACAAAACAAAACAAAACAAAACAAAACAGTAT while mine is
GGGAAAAAACAAAACAAAACAAAACAAAACAAAACAAAACAGTAT

which means as an STR R1b is 6 and I am 7.

L176 is a del.

R1b is TTCTATCCTGTCTATCTAG and I am
TTCTATC----CTATCTAG

None of these are in coding regions.

No word yet from Krahn about whether FTDNA will offer these
as advanced markers "SNPs" ... he's out of town.

Doug McDonald


This thread: