GENEALOGY-DNA-L Archives

Archiver > GENEALOGY-DNA > 2010-02 > 1266188780


From:
Subject: [DNA] A few genealogists might match the Saqqaq ancient eskimo on apart of the X chromosome
Date: Sun, 14 Feb 2010 18:06:20 -0500


There are a couple of genealogists who are numbers 47 and 70 on Ben's
spreadsheet and repeated on the spreadsheet at World Families,
http://www.worldfamilies.net/geo/xdna/results?raw=1 who come rather
close to matching the Saqqaq ancient eskimo in the block staring with
position 75 million.

https://www.23andme.com/you/explorer/chr/?chr=X&pos_start=75003877
count 25 markers
https://www.23andme.com/you/explorer/chr/?chr=X&pos_start=75489527
count 25 markers
https://www.23andme.com/you/explorer/chr/?chr=X&pos_start=76058990
count 15 markers (there are genes after this)

The two genealogists exactly match each other here:
TCCTGGGTATCCACGTTGGCGAGGT
CATCAGTGCCACATAGGCCTGTGCA
CGTCTTCGAAGTCAC

Saqqaq markers:
?CC?GGGT?CCCACGTTG??GAGGT
CATC?G?G?CGCGCAGGC??G?G??
CGTCTTCGAAGTC?T
http://www.cbs.dtu.dk/cgi-bin/saqqaq.cgi
The Saqqaq Genome Database

I wonder if these two genealogists have ancient Siberian ancestry.
I don't know who they are but I find it rather interesting that the
linkage in the markers is close.
I was hoping the eskimo would match somebody starting from position 66
million to 67 million but he is very different in the intergenic areas
here.

Kathy J.




This thread: