GENEALOGY-DNA-L Archives
Archiver > GENEALOGY-DNA > 2011-10 > 1318010625
From: Scott Kendall <>
Subject: Re: [DNA] R-L144 and R-L21
Date: Fri, 7 Oct 2011 13:03:45 -0500
References: <CAJVy7EtWw3rx61HmGTTM75xzRZv=g371wzSHNqf_FebHRHD_qQ@mail.gmail.com><589265355.241401.1318002920879.JavaMail.root@sz0002a.westchester.pa.mail.comcast.net><CAMKu7tdQVpH6C-njyxkjt=J7TjJewG_LWSMyEX-FjMQjaETrWw@mail.gmail.com>
In-Reply-To: <CAMKu7tdQVpH6C-njyxkjt=J7TjJewG_LWSMyEX-FjMQjaETrWw@mail.gmail.com>
We have other descendants of William Kendall c1740 in the study Scat
FTDNA. Should we have the deep clade testing done on one of them?
Thanks!
Scott
On Fri, Oct 7, 2011 at 12:02 PM, Vince Tilroe <> wrote:
> There's another more improbable explanation than a back mutation - that the
> sample which was SNP tested L144 negative may have actually belonged to a
> different man altogether from the descendant of William Kendall, c1740
> Orange County, Virginia who has the 110/111 match with R-L144
>
> Nonetheless, L144 sits at the conjunction of a poly-thymine repeat and a
> poly-adenine repeat, which is an inherently unstable position to begin with.
>
>>ChrY:21120823..21120872
>
> NCBI36: cttaaagcacagggaggtttttttttaaa-ttagcttaagaacgtgagttt
> L144-: Â cttaaagcacagggaggttttttttaaaa-ttagcttaagaacgtgagttt
> L195+: Â cttaaagcacagggaggtttttttttaaaattagcttaagaacgtgagttt
>
> Note that NCBI36 shows L144+ at this segment, and Thomas Krahn stated that
> L195 probably co-mutates with L144.
>
> I would certainly second Kirsten's recommendation to test Z255. Â Testing
> Z254 would also be a good check, if it's available.
>
> Vince T.
This thread:
| Re: [DNA] R-L144 and R-L21 by Scott Kendall <> |