GENEALOGY-DNA-L Archives
Archiver > GENEALOGY-DNA > 2013-02 > 1359988245
From: Ann Turner <>
Subject: [DNA] King Richard III's mtDNA results
Date: Mon, 4 Feb 2013 06:30:45 -0800
The University of Leicester website shows a fragment of the raw mtDNA
readings:
http://www.le.ac.uk/richardiii/science/resultsofdna.html
If I distinguished the colors and letter correctly, the diagram shows a
section of HVR1. The numbering is offset by one from the CRS, presumably
due to the common HVR2 insertion 315.1C.
King Richard III's results are
CAACAACCGCTCTGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCA
The differences from the CRS are A16087C (A to C is a transversion, the
less common type of mutation) and T16126C, which is a marker for
superhaplogroup JT as well as numerous other haplogroup subclades. Debbie
Kennett has said the Michael Ibsen is known to be in haplogroup J.
A16087C is not in GenBank or the Genographic Project's collection of
~50,000 HVR1 records or in the public pages of the Haplogroup J project at
FTDNA.
Ann Turner
This thread:
| [DNA] King Richard III's mtDNA results by Ann Turner <> |