GENEALOGY-DNA-L Archives
Archiver > GENEALOGY-DNA > 2013-02 > 1360004072
From: Ann Turner <>
Subject: Re: [DNA] [ISOGG] King Richard III's mtDNA results
Date: Mon, 4 Feb 2013 10:54:32 -0800
References: <CAA-Ub_AyPO0YjUvW-jYoi4vNjQN+qFmvMu1CFA8RaD_cNTtZfg@mail.gmail.com><510FF53B.1040800@gmail.com>
In-Reply-To: <510FF53B.1040800@gmail.com>
Oh, pooh! You're right -- I must have gotten out of sync transcribing the
sequence, so that interesting mutation is not present. The fragment does
contain the T16126C difference from the CRS, so that is still consistent
with haplogroup J.
On Mon, Feb 4, 2013 at 9:51 AM, Dave Cissell <> wrote:
> Anne,
>
> I found the following sequence, which differs from yours at one location.
> Does this make your analysis easier?
>
> CAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCA
>
>
> Dave Cissell
>
>
> On 2/4/13 6:30 AM, Ann Turner wrote:
>
>
>
> The University of Leicester website shows a fragment of the raw mtDNA
> readings:
>
> http://www.le.ac.uk/richardiii/science/resultsofdna.html
>
> If I distinguished the colors and letter correctly, the diagram shows a
> section of HVR1. The numbering is offset by one from the CRS, presumably
> due to the common HVR2 insertion 315.1C.
>
> King Richard III's results are
> CAACAACCGCTCTGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCA
>
> The differences from the CRS are A16087C (A to C is a transversion, the
> less common type of mutation) and T16126C, which is a marker for
> superhaplogroup JT as well as numerous other haplogroup subclades. Debbie
> Kennett has said the Michael Ibsen is known to be in haplogroup J.
>
> A16087C is not in GenBank or the Genographic Project's collection of
> ~50,000 HVR1 records or in the public pages of the Haplogroup J project at
> FTDNA.
>
> Ann Turner
>
>
>
>
> __._,_.___
> Reply via web post Reply to sender
> <?subject=Re%3A%20King%20Richard%20III%27s%20mtDNA%20results> Reply
> to group
> <?subject=Re%3A%20King%20Richard%20III%27s%20mtDNA%20results> Start
> a New Topic Messages in this topic ()
> Recent Activity:
>
>
> Visit Your Group<http://groups.yahoo.com/group/ISOGG;_ylc=X3oDMTJmM291djVsBF9TAzk3MzU5NzE0BGdycElkAzE0ODc1MTU2BGdycHNwSWQDMTcwNTY5MDkzMgRzZWMDdnRsBHNsawN2Z2hwBHN0aW1lAzEzNTk5ODgzOTA->
> [image: Yahoo! Groups]<http://groups.yahoo.com/;_ylc=X3oDMTJlZ2Fkdm1yBF9TAzk3NDc2NTkwBGdycElkAzE0ODc1MTU2BGdycHNwSWQDMTcwNTY5MDkzMgRzZWMDZnRyBHNsawNnZnAEc3RpbWUDMTM1OTk4ODM5MA-->
> Switch to: Text-Only<?subject=Change%20Delivery%20Format:%20Traditional>,
> Daily Digest<?subject=Email%20Delivery:%20Digest>•
> Unsubscribe <?subject=Unsubscribe> • Terms
> of Use <http://docs.yahoo.com/info/terms/> • Send us Feedback
> <?subject=Feedback%20on%20the%20redesigned%20individual%20mail%20v1>
> .
>
> __,_._,___
>
>
>
This thread: